cash is king real funds flows can be seen in cash but not in accounting profit interest charges become payable as soon as money is made available for example from a lender to a borrower not when an agreement is made or a contract is signed
Tài liệu Write Data Validation Code That Can Be Reused in Other Classes docx
Ngày tải lên :
24/12/2013, 06:17
... regular class, an abstract class does contain some implemented methods and properties, and even though it cannot be instantiated, it can have constructors Table 9.3 Visual Basic NET Class Inheritance ... MustInherit keyword means that the CNumberString class cannot be instantiated directly Instead, the class must be inherited by another class for its members to be accessed Listing 9.47 PhoneDatatypes.vb: ... functionality of a fifth base class Before you begin coding so many classes, it is always a good idea to plan precisely what you want to write Figure 9.8 is a class diagram that describes the classes...
- 16
- 360
- 0
Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps
Ngày tải lên :
10/08/2014, 09:21
... showing complete replacement of ascending aorta and aortic arch, the FET in the descending thoracic aorta and the saphenous vein grafts originating from the ascending aorta (b.) Axial CT image ... stent-grafting of the aortic arch and descending aorta was unsuitable for our patient due to aneurysmal dilatation of the entire thoracic aorta and concomitant cardiac pathology Kokotsakis et al ... tissue in the suprasternal area in order to avoid the low-lying permanent tracheostomy A right subclavicular incision was also made and the right axillary artery was exposed Cardiopulmonary bypass...
- 5
- 571
- 0
Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot
Ngày tải lên :
09/08/2014, 07:20
... [4] Radiographs only reveal gross anatomical changes It usually takes at least one year before significant changes in joint damage can be observed This delay means there is a need for more sensitive ... different rates of RA progression [13] An ELISA format was used in the present study, whereas a radioimmunoassay format was used in previous studies [13,14] Another ELISA assay was used to measure ... radiographic joint damage is important because differences in clinical parameters such as inflammation might not always correlate with radiographic out- Available online http://arthritis-research.com/content/8/1/R31...
- 9
- 525
- 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
Ngày tải lên :
14/08/2014, 08:20
... one another because the physical chemists speak a different jargon from synthetic organic chemists and so on And he says that biologists are better off because most biologists can go to any talk ... way to help scientists understand not dogs, but each other Clifford: Now I’m the one who’s not understanding Mink: What I mean is that Greg is always complaining that chemists can t understand ... by any other biologist, whether they are a structural biologist or a cell biologist or a geneticist or an immunologist or a genome scientist, and understand most of what’s being said They can...
- 2
- 190
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
Ngày tải lên :
14/08/2014, 08:21
... receptor phosphatase LAR [23] In addition, it has been proposed that glypicans can be involved in the uptake of polyamines [24] Glypicans can also be shed into the extracellular environment This ... [22] This hypothesis is based on the finding that glypicans can bind to Wnts and to Frizzleds [16,18,22,36], and that transfection of glypicans increases the Wnt-binding capacity of the transfected ... proteoglycans can interact in a rather promiscuous way with proteins that display positively charged domains On this basis it was originally thought that the HS chains were essential for glypican activity...
- 6
- 390
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
Ngày tải lên :
14/08/2014, 14:21
... 208856 tTGAAAAcaAaaaTCAa Has P-type ATPase/hydrolase domains 4.49 -176 4.25 tTGAcAATGATTTTCtT HD-domain protein -182 -93 4.46 ATGAtttTCtTTTTCAa hdd* Flavodoxin 4.31 AcaAAAATCAaTTTCAa 208641 fld* ... desulfuricans 392869 209119 Hypothetical protein conserved in Archaea TTGTtAAATAaTTCACAA -118 395578 apsAB APS reductase TTGTtAAATATcTCACAA -186 5.77 394579 sat ATP sulfurylase TTGctAAAaATTTCACAA -147 ... DD|395578 DV|206272 CTGTTGACAGTGTAAGGTGAGCTTTGTTAAATATCTCACAAGCGCA-CGGGCCAACGAACTCGTAAAAGTCTCCGTTAGGCA CGCTTGACACATCAGGGGTGACATTGTTAATTCCATCACAAGCGCAGCGGGCTCCCCA -CAACGAAGTGTT G * ****** * **...
- 27
- 356
- 0
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone
Ngày tải lên :
27/06/2016, 10:30
... Message Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will ... should not be a crutch to hide behind Remember! • A picture is worth a thousand words” • Interesting visuals as backdrop is far more important than pages of text • Lots of colour is usually good ... present, not the laptop • Is about the message you want to convey Presentation • Like a glass containing good whisky • The glass contain the whisky so that people can appreciate and savour it • Allow...
- 23
- 393
- 0
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE
Ngày tải lên :
04/04/2013, 16:17
... point, and an increase in quantity demanded that will be met by exporters Therefore, an increase in quantity demanded will lead to an increase in quantity supplied, that means international trade will ... can be made: physical characteristics, import charges and indirect taxes, discounts, rebates and quantities, level of trade, transport, insurance, handling, loading, and ancillary costs, packing, ... 'Framework for the preparation and presentation of financial statements' that 'the objective of financial statement is to provide information about the financial position, performance and changes in financial...
- 66
- 538
- 4
Without grammar very little can be conveyed, without vocabulary nothing can be conveyed
Ngày tải lên :
05/04/2013, 15:56
... include: an active task approach, realization of language as a system, realization of language as a means of communication and interaction, management of affective demands, and monitoring of L2 performance ... determining their meaning Studying a word’s affixes, root, and word class is potentially useful as a way of consolidating its meaning Paraphrasing can be used as a strategy to compensate for limited ... polite conversation, or tends to be used in writing but not in speech, or is more suitable for a formal than informal discourse or belongs to a certain dialect Associations or meaning relationships...
- 48
- 1.3K
- 0
Without grammar very little can be conveyed, without vocabulary nothing can be conveyed
Ngày tải lên :
17/04/2013, 10:12
... include: an active task approach, realization of language as a system, realization of language as a means of communication and interaction, management of affective demands, and monitoring of L2 performance ... determining their meaning Studying a word’s affixes, root, and word class is potentially useful as a way of consolidating its meaning Paraphrasing can be used as a strategy to compensate for limited ... for ;1 cognate Analyze any available pictures or gestures Guess the meaning from textual context 16 Bilingual dictionary Word lists Flash cards Ask teacher for an L1 translation Ask teacher for...
- 35
- 1.8K
- 1
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?
Ngày tải lên :
27/07/2013, 08:50
... imported, on any reasonable basis In these cases, adjustment for all costs, including duties and taxes, incurred between importation and resale, and for profits accruing, shall be made so as to ... will be a new equilibrium point, and an increase in quantity demanded that will be met by exporters Therefore, an increase in quantity demanded will lead to an increase in quantity supplied, that ... 'Framework for the preparation and presentation of financial statements' that 'the objective of financial statement is to provide information about the financial position, performance and changes in financial...
- 84
- 544
- 0
Drilling Can Be Fun
Ngày tải lên :
06/09/2013, 10:10
... whereas 'Can you speak more quietly please' goes the other way Similarly with 'Could you speak faster/more slowly please?' 'Could you repeat that/say that again please?' can go on indefinitely! Say ... with words and meanings Polite Requests You can have fun with polite request drills For example 'Can you speak more loudly, please', can start very quietly and continue until everyone is shouting, ... you listen to me please?' and get them to repeat, then stare at them as if they are going to say something important! When they can say the sentences well you can switch between requests, slowing...
- 3
- 304
- 0
What can be done
Ngày tải lên :
01/11/2013, 09:20
... Catalonia, for example, has been a major factor in encouraging the use of Catalan there, and this has enhanced the prestige of the language in other Catalan-speaking areas Service industries and ... outside organizations.) Tourism is a good example of a service industry which can bring considerable benefits to an endangered language, as has been seen What can be done? 133 in parts of Switzerland ... [to become language scholars], train them, and step aside.’ For examples of teacher-training programmes, see the American Indian Language Development Institutes in Arizona and Oklahoma described...
- 40
- 436
- 0
Information Contained in EPA’s Regulatory Impact Analyses Can Be Made Clearer pdf
Ngày tải lên :
06/03/2014, 19:20
... Not clearly indicated RIA for the National Emissions Standards for Hazardous Air Pollutants for Source Categories: Organic Hazardous Air Pollutants From Synthetic Organic Chemical Manufacturing ... different values assumed for a life Assigning a relatively high value for human life can have a significant positive effect on estimated benefits However, for the nine RIAs that assumed a value for a ... Flexibility Analysis of the Enhanced Monitoring Program 10 $1.58 RIA and Regulatory Flexibility Analysis of Proposed Effluent Guidelines and National Emissions Standards for Hazardous Air Pollutants for...
- 21
- 276
- 0
Why do Internet services fail, and what can be done about it? ppt
Ngày tải lên :
06/03/2014, 21:20
... this, APIs for emerging services should allow for easy online testing, fault injection, automatic propagation of errors to code modules and /or operators that can handle them, and distributed data-flow ... example, was reimaging the backup machine after the primary had failed really an operator error, if the operator was unaware that the primary had failed? Was intentionally leaving the tape backup ... operator intent is a form of semantic redundancy, a technique that is useful for catching errors in other contexts (types in programming languages, data structure invariants, and so on) Unfortunately...
- 15
- 387
- 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf
Ngày tải lên :
07/03/2014, 03:20
... This indicates that rSHaPrP can be used as a substrate for PrPSc propagation in the presence of NADPH using PMCA Fig rSHaPrP, but not rHuPrP, could be converted into a PK-resistant isoform in ... studies have revealed that NADPH-diaphorase, which is known to catalyse NADPH to transfer electrons to their targets, is associ- ated with neuronal death [30] Increasing hippocampal NADPH-diaphorase ... results indicate that propagation of SHa-13 9A in vitro can also be prompted by NADPH, and therefore this enhancement of PrPSc propagation in PMCA is not limited to only one prion strain NADPH increased...
- 10
- 342
- 0
The Research Tax Credit’s Design and Administration Can Be Improved potx
Ngày tải lên :
15/03/2014, 07:20
... factors other than just the statutory rate of a tax credit can also be important in determining its marginal incentive Measures that take those other factors into account are commonly known as ... of assumptions that we examined, when an ASC is the only option available, an ASC with a 50-percent minimum base could provide the same average MER as an ASC without a minimum base, but at a lower ... nonqualifying ordinary quality control testing and qualified validation testing These determinations are made on a case-by-case basis for each activity The official also said that they have disagreements...
- 119
- 1.7K
- 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
Ngày tải lên :
23/03/2014, 04:20
... determinant located in the second transmembrane domain of Cx43 Although not as common as cytoplasmic sorting signals, transmembrane sorting signals have been identified For example, the gastric ... used: Y28 6A, 5¢-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3¢; LSYTRF, 5¢-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3¢ The complementary sequences ... tyrosine or dileucine-based sorting signal located in the cytoplasmic tail A common tyrosine-based consensus sorting motif is YXXø (where Y is tyrosine, X is any amino acid, and Ø is an amino acid...
- 14
- 433
- 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
Ngày tải lên :
01/06/2014, 10:54
... the chance to major in one discipline and minor in another Essentially, that means you are 12 What Can You Do with a Major in Biology? choosing one primary area of study as well as a secondary ... biology) does not necessarily mean a similar ranking in another major or area; (3) you can find little difference between, say a ranking of 25 and 30; and (4) a college that is excellent for one student ... need an advanced degree or want to continue learning through internships I explain what an internship is, how you can apply for one, and point you toward some ways to find organizations that offer...
- 142
- 375
- 0
How Vietnamese Attitudes can be Recognized and Confused: CrossCultural Perception and Speech Prosody Analysis
Ngày tải lên :
18/06/2014, 10:19
... listeners or both of them may be explained by the assumption that such kinds of attitudes cannot be distinguished satisfactorily from others on the basis of audio information only, outside any ... pertinent interaction context: the listeners may need more information – and particularly visual information from the face or from gestures to distinguish such attitudes It raises interesting ... Vietnamese attitudes Overall, most attitudes have the duration from 0.8 to 1s 222 linguistic knowledge of a tonal language: will they be able to separate tonal from attitudinal information? contour,...
- 4
- 405
- 0